Specimen #12
Figure 1: Cap of Tyromyces leucospongia showing a lack of stalk.
Figure 2: Tubes of Tyromyces leucospongia
Name: Tyromyces
leucospongia
Common name: Marshmallow Polypore
Family: Polyporaceae
Common name: Marshmallow Polypore
Family: Polyporaceae
Collection Date:
Habitat: On fallen hardwood tree
Location: Nelson Ledges
Description: Originally plush and all white. No stalk. When it dried it turned brown.
Key used: PCR
Keying Steps:NZ8F
TGGGAGGGTGATTGCAGATTCAGTGATCTCGATCTTTGAACGCACCTTGCGCTCCTTGGTTTCCGAGGAGCTTGGGCGGTCCACCCTTTTAAATCAAAAACCCGGTGTGGGGGGGTCACCGGCTTTTTTAGAGAAAAGCAG
It took some digging throughout the
blast hits. All of the hits were shelf
fungus hits. A quarter of the way down
was Tyromyces hit which began to lead
me in the right direction. When doing PCR
on this fungus it was all white and then turned brown with age. This matches the description of leucospongia. I was reassured of making the conclusion that
this was leucospongia once I stumbled
across it because it jogged a memory from when I went on the mushroom foray (a
few weeks later). One of the experts had
pointed out an identical, all white shelf fungus and called it marshmallow
fungus.
Specimen #13
Figure 1: Cap of Trametes versicolor
Figure 2: Pores and flower-like underside of Trametes versicolor
Name: Trametes
versicolor
Common name: Turkey tail
Family: Polyporaceae
Common name: Turkey tail
Family: Polyporaceae
Collection Date: 11/16/16
Habitat: In the woods on a decaying branch.
Location: Behind the grass soccer field at Hiram College.
Description: Fan-like, rings of color, growing in clusters. Very thin flesh, very common fungi. The pore
surface is light brown.
Key used: Arora, David. 1986.
Mushrooms demystified: A comprehensive guide to the fleshy fungi. Berkeley: Ten
Speed Press.
Keying Steps:
Pg. 52. Polypores and Bracket Fungi pg. 549.
1. Not as above; fruiting body tough 2.
2. Fruiting body bracketlike, shelflike,
growing on wood 4.
4. Pore surface exposed, not growing on
birch 5.
5. Not as above 6.
6. Fruiting body resupinate 7.
7. Spore bearing surface comprised of
true tube layers 8.
8. Spore-bearing surface with tubes 10.
10. Not with above features 11.
11. Not as above, fruiting body small,
tough 12.
12. Not as above, flesh collored light
brown or salmon tinged, white 13.
13. Not as above 14.
14. Not as above, not nest like 15.
15. Not as above, very common 16.
16. Pore surface brown Pg. 592 Key to Trametes and Allies
Pg. 592 Key to Trametes and Allies
1. Not as above 2.
2. Fertile surface, not rosy 4.
4. Fruiting body not fleshy 5.
5. Not as above 6.
6. Cap not hairy 9.
9. Not as above 10.
10. Cap velvety, very common 11.
11. Cap is zoned with different colors,
very common 12.
12. Cap typically 2-7 cm broad with
zones of contrasting colors, surface velvety, Trametesversicolo pg. 594.
Specimen #14
Figure 1: Cap gills, and distinct bulb of Lepiota rachodes
Name: Lepiota rachodes
Common name: Shaggy parasol
Family: Agaricaceae
Common name: Shaggy parasol
Family: Agaricaceae
Collection Date: 11/16/16
Habitat: Grassy hillside near fallen logs and under a living hardwood tree.
Location: Behind the grass soccer field at Hiram College.
Description: Has a bulb, white with brown scales, dry, veil present with age, younger ones do not have gills exposed yet, thick stalk, growing in clusters.
Key used: Arora, David. 1986. Mushrooms demystified: A comprehensive guide to the fleshy fungi. Berkeley: Ten Speed Press.
Keying Steps:
Pg. 52. Basidiomycete
Fruiting body with cap and stalk, spores borne on gills, Agarics pg 58.
Pg. 59 Key to Agaricales
1. Gills exposed at maturity, common and widespread 2.
2. No spore print taken, guess and check of all possibilities. 3.
3. Neither volva or worts present. 4.
4. Veil present and gills free 5.
5. Cap dry, stalk dry Lepiotacea pg. 293.
Pg. 293 Key to the Lepiotaceae
1. Fruiting body, medium sized, stalk thick, veil distinct 2.
2. Not as above 3.
3. Not as above, scales not rub off easily 4.
4. Not as above 5.
5. Not as above 6.
6. Cap white to brownish 7.
7. Cap not reddish, or pink 8.
8. Stalk terminating at a bulb L. rachodes pg. 297.
Specimen #15
Figure 1: Thallose structure of Hyperphyscia
Name: Hyperphyscia
Common name: none
Family: Physciaceae
Common name: none
Family: Physciaceae
Collection Date: 11/16/16
Habitat: On a rock near a source of constant water.
Location: Behind the grass soccer field at Hiram College.
Description: Soft, leafy, green. -KOH, -Chlorox.
Key Used: http://ohiomosslichen.org/wp-content/uploads/2013/08/KEY-TO-OHIO-GENERA-OF-MACROLICHENS.pdf
Keying Steps:
1. Thallus some shade of gray, green, yellow-green, brown, or black 5.
5. Thallus thick or thin, not gelatinous when wet 7.
7. Rhizines lacking 8.
8. Folisose with narrow lobes 9.
9. Thallus not inflated or perforated, very tightly appressed 10.
10. Thallus gray-brown, usually on bark Hyperphyscia
